A general note on coding assignments

"I got stuck on a problem in the assignment, am I going to fail?"

No, if you make it clear you ran the notebooks and made an effort to find answers (submit your code with errors, include comments on what you tried) you will get full points. We will go over everything in class. Also, visit the chatroom!

A general note on coding assignments

These first few weeks are like a crash course in coding so that we can do exciting things later using these skills. We will turn soon to much stronger focus on genomics and just start recycling these coding skills each week.

Notebook 2.0: Intro to Python

Python objects.

  # Create objects of various types using their type conventions
  "a string"
  ["a", "list", "of", "strings"]
  ("a", "tuple", "of", "strings")
  {"a key": ["and value in a dictionary"]}
        

  # Or, we can explicitly use the object type function to creating objects
  str("Columbia")
  list((1, 2, 3, 4, 5))
  tuple("apple", "banana", "orange")
  dict([("a", 3), ("b", 4), ("c", 5)])
        

Notebook 2.0: Intro to Python

Creating variables to store objects

  # Create objects of various types using their type conventions
  a = "a string"
  b = ["a", "list", "of", "strings"]
  c = ("a", "tuple", "of", "strings")
  d = {"a key": ["and value in a dictionary"]}
        

  # Or, we can explicitly name the object type as a function
  a = str("Columbia")
  b = list((1, 2, 3, 4, 5))
  c = tuple("apple", "banana", "orange")
  d = dict([("a", 3), ("b", 4), ("c", 5)])
        

Notebook 2.0: Intro to Python

The string object type

  # Wrap any text in single or double quotes to create a string
  a = "a string"
  b = 'another string'
  c = "A very long string ....................."
  DNA = "ACGCAGTCGATGCTAGCTAGCTGACTGATCGTA"
        

Notebook 2.0: Intro to Python

The integer and float object types.

  # numeric values (ints or float)
  a = 0
  b = 10
  c = 3300.239291
  d = 0.0000301
        

Notebook 2.0: Intro to Python

Challenge 1: In a code cell below write three lines of Python code. On line 1 create a new variable called 'y' with the value 30. On line 2 create another new variable 'z' with the value 5.5. On line 3 use the print function to print the value of y / z.
(See Chapter 3 if you need help).

  y = 30
  z = 5.5
  print(y / z)
        

  5.454545454545454
        

Notebook 2.0: Intro to Python

A function is a program that perform a task. Functions end in parentheses.
Example: the len() function returns the length of an object.

  # Create a string 
  DNA = "ACTACTACTACTACTACTAC "

  # return the length of the string
  len(DNA)
          

  20
          

Notebook 2.0: Intro to Python

Object-oriented: everything is an object.
It is hard to remember all of the functions in a language, and which type of objects each function is designed to operate on. To make life easier, the functions that operate on a specific object (e.g., a string) are accessible from the object itself.

  # Create a string 
  DNA = "ACTACTACTACTACTACTAC"

  # access functions for string objects from the string object
  DNA.lower()
          

  "actactactactactactac"
          

Interactive Python (it's here to help you)

The interactive nature of Python in jupyter. Use [tab]-completion to view attributes/functions of objects. Easier than memorizing!

Notebook 2.0: Intro to Python

Indexing and slicing using brackets

  # Select subsets of an object by their position (starting at 0)
  DNA = "ACTACTACTACTACTACTAC"
  DNA[0]
          

  "A"
          

  DNA = "ACTACTACTACTACTACTAC"
  DNA[1:5]
          

  "CTAC"
          

Notebook 2.0: Intro to Python

Challenges 2-3:
Use indexing to return only the first 10 characters of dna; and only the last 5.
(See Chapter 3.1.2 if you need help)

  dna = "ACGCAGACGATTTGATGATGAGCATCGACTAGCTACACAAAGACTCAGGGCATATA"
  dna[:10])
        

  "ACGCAGACGA"
          

        
  dna[-5:])
        

  "ATATA
          

Notebook 2.0: Intro to Python

Challenge 4: Use the split() function to split the dna variable on the characters "CG". Store the return values to a new variable called dnalist. Then use print on that variable to show its values.

  # the dna string variable
  dna = "ACGCAGACGATTTGATGATGAGCATCGACTAGCTACACAAAGACTCAGGGCATATA"

  # call split with the argument "CG" and store results as dnalist
  dnalist = dna.split("CG")

  # print to show the value of dnalist
  print(dnalist)
        

  ['A', 'CAGA', 'ATTTGATGATGAGCAT', 'ACTAGCTACACAAAGACTCAGGGCATATA']
          

Notebook 2.0: Intro to Python

Challenge 5: In the cell below create two new variables, one called fiveprime that contains the first ten 10 elements in dnalist, and another called threeprime that contains the last 10 elements in dnalist.

  # the dna string variable
  dna = "ACGCAGACGATTTGATGATGAGCATCGACTAGCTACACAAAGACTCAGGGCATATA"

  # make dna string into a list object
  dnalist = list(dna)

  # index the first ten items and store as fiveprime
  fiveprime = dnalist[:10]

  # index last ten items and store as threeprime
  threeprime = dnalist[-10:]
        

Notebook 2.1: Conditional statements

Indentation in Python has meaning, where nested lines are influenced by the less indented lines above them. For example, a for-loop.

  # format: for each item in container of items do x with item
  for letter in "aeiou":
      print(letter)
        

        
  "a"
  "e"
  "i"
  "o"
  "u"
        

Notebook 2.1: Conditional statements

Conditional statements include code that only runs if something is True or False. The special keyword if is used here.

  # for item in container of items do x with item if it's the right kind.
  for letter in "aeiou":
      if letter == "a"
          print(letter)
        

        
  "a"
        

Notebook 2.1: Conditional statements

Challenge 6: Count number of differences between dna1 and dna2. Hint, create an integer variable set to 0 and add 1 to it for each difference. Iterate through each object comparing items. You may find that using the `range` function and indexing the objects is easiest. (See Chapter 4.3).

  # the two string objects
  dna1 = "AACTCGCTAAAGCCTCGCGGATCGATAAGCTAG"
  dna2 = "AAGTCGCTAAAGCAACGCGGAACGATAACCTGG"            
  
  # Hint 1: create an integer variable set to 0
  diffs = 0

  # Hint 2: use the range function and index each object while iterating
  for idx in range(len(dna1)):
      dna1_value = dna1[idx]
      dna2_value = dna2[idx]
      if dna1_value != dna2_value:
          diffs += 1
        

        
  6
        

Notebook 2.2: Functions

Functions are used to perform a repeated task. As we said there are many functions available in Python. In addition, you can write your own by using def()

  # a function to add 100 to x
  def myfunc(x):
      return x + 100

  # run the function on an input value (e.g., 200)
  myfunc(200)
        

        
  300
        

Notebook 2.2: Functions

Functions are used to perform a repeated task. As we said there are many functions available in Python. In addition, you can write your own by using def()

  # name the function and the arguments anything you want
  def sumfunc(arg1, arg2):
      summed = arg1 + arg2
      return summed

  # run the function
  myfunc(200, 300)
        

        
  500
        

Notebook 2.2: Functions

Challenge 7: Describe this function.

  def base_frequency(string):
      "returns the frequency of A, C, G, and T as a list"
      freqs = []
      slen = len(string)
      for base in "ACGT":
          freqs.append(string.count(base) / slen)
      return freqs

  # test the function
  base_frequency("ACACTGATCGACGAGCTAGCTAGCTAGCTGAC")
        

        
  [0.28125, 0.28125, 0.25, 0.1875]
        

Notebook 2.2: Functions

Challenge 8: Write an alternative implementation of base_frequency()

  def base_frequency(string):
      "returns the frequency of A, C, G, and T as a list"     
      total_len = len(string)
      freqA = string.count("A") / total_len
      freqC = string.count("C") / total_len
      freqG = string.count("G") / total_len      
      freqT = string.count("T") / total_len      
      return [freqA, freqC, freqG, freqT]

  # test the function
  base_frequency("ACACTGATCGACGAGCTAGCTAGCTAGCTGAC")
        

        
  [0.28125, 0.28125, 0.25, 0.1875]
        

Notebook 2.2: Functions

Importing libraries: the random library

  import random

  # generate one random number between 0 and 10
  random.randint(0, 10)

  # return a list of 10 random numbers
  [random.randint(0, 10) for i in range(10)]
        

        
  [0.28125, 0.28125, 0.25, 0.1875]
        

Notebook 2.2: Functions

Challenge 9: Write a function using random to generate a random sequence of DNA (As, Cs, Gs, and Ts) of a length that is supplied as an argument. It should return the results as a string object. Demonstrate by generating a 20 base pair long sequence of DNA.

  def random_dna(length):
      "returns a random string of ACGTs of len length"
      dna = ""
      for i in range(length):
          dna += random.choice("ACGT")
      return dna
  
  # test it out
  random_dna(20)
      

        
  "AGGTTTTACCGGTATGAGTC"
        

Notebook 2.3: Files I/O

The things we did with bash code in the first tutorial can all be run in Python as well.

  %%bash
  mkdir -p datafiles/
  wget http://eaton-lab.org/data/40578.fastq.gz -q -O datafiles/40578.fastq.gz
  wget http://eaton-lab.org/data/iris-data-dirty.csv -q -O datafiles/iris-data-dirty.csv
        

  # make a new directory
  os.makedirs("datafiles2", exist_ok=True)

  # download files to that directory
  url1 = "http://eaton-lab.org/data/40578.fastq.gz"
  with open("./datafiles2/40578.fastq.gz", 'wb') as ffile:
      ffile.write(requests.get(url1).content)

  url2 = "http://eaton-lab.org/data/iris-data-dirty.csv"
  with open("./datafiles2/iris-data-dirty.csv", 'wb') as ffile:
      ffile.write(requests.get(url2).content)
        

Notebook 2.3: Files I/O

Writing to files in Python.

  # open a file object in write-mode 
  ofile = open("./datafiles/helloworld.txt", 'w')

  # write a string to the file
  ofile.write("hello world")

  # close the file object
  ofile.close()
        

  # a simpler alternative: use 'with', 'as', and indentation
  with open("./datafiles/helloworld.txt", 'w') as ofile:
      ofile.write("hello world")
        

Notebook 2.3: Files I/O

Reading data from files in Python

  # open a file object in read-mode 
  infile = open("./datafiles/helloworld.txt", 'r')

  # call the read or readlines function to get the data.
  data = infile.read()

  # close the file object
  infile.close()
        

  # a simpler alternative: use 'with', 'as', and indentation
  with open("./datafiles/helloworld.txt", 'r') as infile:
      data = infile.read()
        

Notebook 2.3: Files I/O

Challenge 10: Use random function to generate a DNA sequence, and combine it with "> name" to make a valid fasta formatted DNA sequence. Then write it to a file.

  # create a fasta formatted DNA sequence
  dna = random_dna(20)
  name = "> sequence name"
  fasta = name + "\n" + dna

  # write it to a file
  with open("datafiles/sequence.fasta", 'w') as out:
      out.write(fasta)

  # print fasta for demonstration
  print(fasta)
        

        
  > sequence name
  CACGAATGCGTAATCTTATC         
        

Notebook 2.3: Files I/O

Challenge 11: Write function to convert fastq to fasta. (1) Write a function; (2) read 'datafiles/40578.fastq.gz' from disk; (3) convert to fasta format; and (4) write result to a file
Trick: use print for debugging.

  # 1. write a function
  def converter(fastq_file):

      # 2. read in the fastq file
      with gzip.open(fastq_file, 'rb') as indata:
          fastq = indata.read().decode()

      # 3. convert to fasta: start with an empty list
      fastadata = []

      # split file into separate reads on @ delimiter
      reads = fastq.split("@"):
      for read in reads:
          # split read into 4 lines
          lines = read.split("\n")

          # join ">", line[0], and line[1] to make fasta formatted sequence
          fastadata.append("> " + lines[0] + "\n" + lines[1])

      # join strings in the list back together into a string
      fasta = "\n".join(fastadata)

      # write to a file
      with open("datafiles/sequence.fasta", 'w') as out:
          out.write(fasta)